Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Neisseria gonorrhoeae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR1281 IGR1279 IGR1280 IGR1278 IGR1282 IGR1282.4 IGR1282.2 IGR1282.3 IGR1282.1 NG1568.1 galM, - NG1571 NG1569 nadC, - NG1565 NG1566 NG1570 nadA, - NG1567 nadB, - NG1568 NG1568.1 galM, - NG1571 NG1569 nadC, - NG1565 NG1566 NG1570 nadA, - NG1567 nadB, - NG1568 Type: tandem, Name:  - 72 Type: tandem, Name:  - 73 Type: inverse, Name:  - 162 Type: inverse, Name:  - 172 NG1568.1 galM, - NG1571 NG1569 nadC, - NG1565 NG1566 NG1570 nadA, - NG1567 nadB, - NG1568

IGS ID: IGR1282

DNA Molecule Name:
1  

IGS Start:
1541036

IGS Stop:
1541280

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TAAGGTTGGCTGGTTAGAAAAAAATCGTTCAAATAAATTTGAATAGCATG
GTTAAGAGATTGGCATTCAGTTTTTATGGTTGCGTAAGTTGGGTTGAGGC
CTTTGCAAAAAAGCCCTTCCTTCGACATCCGAAACCCAAACACAGGTTTT
CAGCTGTTTTCGCCCCAAATACCTCCTAATTTTACCCGAATATCCCCTTA
ATCCTCCCCGGATACCCGATAATCAGGCATCCGGGCCGCCTTTTA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy