Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Neisseria gonorrhoeae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR1277 IGR1274 IGR1281 IGR1276 IGR1275 IGR1279 IGR1273 IGR1272 IGR1280 IGR1278 IGR1282 IGR1282.2 IGR1282.1 NG1558 arsR, - NG1562 NG1568.1 xthA, - NG1561 NG1569 nadC, - NG1565 NG1566 NG1560 NG1563 NG1564 ompA,yiaD, - NG1559 nadA, - NG1567 nadB, - NG1568 NG1558 arsR, - NG1562 NG1568.1 xthA, - NG1561 NG1569 nadC, - NG1565 NG1566 NG1560 NG1563 NG1564 ompA,yiaD, - NG1559 nadA, - NG1567 nadB, - NG1568 Type: inverse, Name:  - 162 Type: inverse, Name:  - 172 NG1558 arsR, - NG1562 NG1568.1 xthA, - NG1561 NG1569 nadC, - NG1565 NG1566 NG1560 NG1564 ompA,yiaD, - NG1559 nadA, - NG1567 nadB, - NG1568 NG1563

IGS ID: IGR1280

DNA Molecule Name:
1  

IGS Start:
1538165

IGS Stop:
1538332

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
GCTCGGCTTTCTGCGGGTGGGAAAGGCTTTATTGTAAACCAAAGCGGTTT
GTCGGAACGAAGCGGGTCGGTTTTGCGGTATCGCAAACCTGTTTTCAGAC
GACCTTGCATATTATACTCAAGTTGAGCATAATGTAAAAACAGTTTGAAA
AACAGACGGCAAACCTTC



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy