Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Neisseria gonorrhoeae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR1277 IGR1270 IGR1274 IGR1276 IGR1275 IGR1279 IGR1273 IGR1272 IGR1271 IGR1280 IGR1278 IGR1269.1 NG1558 arsR, - NG1562 NG1556 xthA, - NG1561 nadC, - NG1565 NG1566 NG1560 NG1563 NG1564 NG1557 ompA,yiaD, - NG1559 nadA, - NG1567 putA, - NG1554 NG1558 arsR, - NG1562 NG1556 xthA, - NG1561 nadC, - NG1565 NG1566 NG1560 NG1563 NG1564 NG1557 ompA,yiaD, - NG1559 nadA, - NG1567 putA, - NG1554 Type: direct, Name:  - 129 Type: inverse, Name:  - 157 NG1558 arsR, - NG1562 NG1556 xthA, - NG1561 nadC, - NG1565 NG1566 NG1560 NG1564 NG1557 ompA,yiaD, - NG1559 nadA, - NG1567 putA, - NG1554 NG1563

IGS ID: IGR1274

DNA Molecule Name:
1  

IGS Start:
1534381

IGS Stop:
1534425

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TGAAACCCTGCGAAGTTTCAGACGGCATTTGCCTTTCCCGAATTA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy