Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Neisseria gonorrhoeae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR1251 IGR1257 IGR1250 IGR1253 IGR1256 IGR1254 IGR1252 IGR1255 NG1538 NG1536 murG, - NG1533 mraY, - NG1537 ftsW, - NG1534 murD, - NG1535 murF, - NG1539 murE, - NG1541 murC, - NG1532 dca, - NG1540 NG1538 NG1536 murG, - NG1533 mraY, - NG1537 ftsW, - NG1534 murD, - NG1535 murF, - NG1539 murE, - NG1541 murC, - NG1532 dca, - NG1540 NG1538 NG1536 murG, - NG1533 mraY, - NG1537 ftsW, - NG1534 murD, - NG1535 murF, - NG1539 murE, - NG1541 murC, - NG1532 dca, - NG1540

IGS ID: IGR1254

DNA Molecule Name:
1  

IGS Start:
1509135

IGS Stop:
1509261

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
GGTTTTCTCCTGTTTTAGTATAAGGCGGGTTTCAGCCGCCGTTAACGATA
GGACGGGGCGGATTGCCGCCGCAGGTTTATTGCGCGTTCAAATGCCGTCT
GAAAGGTGTTCGGACGGCATAGGTTCA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy