Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Neisseria gonorrhoeae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR1200 IGR1196 IGR1198 IGR1201 IGR1199 IGR1197 IGR1194 IGR1202 IGR1195 NG1465 mdaB, - NG1473 serB, - NG1468 opaG,PII, - NG1464 NG1467 purH, - NG1466 NG1469 NG1462 NG1471 pntB, - NG1472 pntA, - NG1470 NG1465 mdaB, - NG1473 serB, - NG1468 opaG,PII, - NG1464 NG1467 purH, - NG1466 NG1469 NG1462 NG1471 pntB, - NG1472 pntA, - NG1470 Type: tandem, Name:  - 66 Type: tandem, Name:  - 67 Type: inverse, Name:  - 157 NG1465 mdaB, - NG1473 serB, - NG1468 opaG,PII, - NG1464 NG1467 purH, - NG1466 NG1469 NG1462 NG1471 pntB, - NG1472 pntA, - NG1470

IGS ID: IGR1198

DNA Molecule Name:
1  

IGS Start:
1432138

IGS Stop:
1432203

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TGTCGTTCCTGCCGTTCAAATGCCGTCTGAAAACCTTTCAGACGGCATCC
GTTTCCTATCCGCCTA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy