Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Neisseria gonorrhoeae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR1196 IGR1190 IGR1191 IGR1193 IGR1189 IGR1187 IGR1197 IGR1194 IGR1195 IGR1192 IGR1188 NG1465 NG1461 opaG,PII, - NG1464 NG1467 NG1455 purH, - NG1466 NG1460 NG1459 NG1457 NG1462 NG1458 pepP, - NG1456 NG1465 NG1461 opaG,PII, - NG1464 NG1467 NG1455 purH, - NG1466 NG1460 NG1459 NG1457 NG1462 NG1458 pepP, - NG1456 Type: inverse, Name:  - 157 Type: tandem, Name:  - 65 Type: tandem, Name:  - 66 Type: tandem, Name:  - 67 NG1465 NG1461 opaG,PII, - NG1464 NG1467 NG1455 purH, - NG1466 NG1462 NG1458 pepP, - NG1456 NG1459 NG1457 NG1460

IGS ID: IGR1192

DNA Molecule Name:
1  

IGS Start:
1426174

IGS Stop:
1426496

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TAAATACAAGCCTTGCGGCTTGTTGCCCTCTCTCCAGCCCTCTCCCACGG
GGAGAGAGGACGGGGAGGCTGTTGGGGTTAAGGGTTTTGTAAACTAATCA
GGTTGTGCAGGCTGCTTTTTGCTTTTCAGACGACCTGAAATCAACGGTTG
TAAATCCAATCTGTTTTTCAAACCGCCTGCAACCGCCAAATCTGCCGCAA
CCTGCCCCCTCCCCCGTGGGGGAGAGGGCTCCCCGAATTTCGACAATCTT
TCCCAAATCCCTTAGTCTTCTAAAATACAAGCCTTGCAGCTTTCTAGCTC
TCTCCCACAGGGAGAGAGGACTA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy