Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Neisseria gonorrhoeae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR1070 IGR1069 IGR1067 IGR1065 IGR1066 IGR1068 IGR1073.1 IGR1072 IGR1071 IGR1073.2 IGR1073 rpoZ, - NG1309 gmk,kguA, - NG1310 NG1312 tbpA,hmbR, - NG1316.1 tbpA, - NG1316 spoT, - NG1308 NG1313 NG1315 aprt,apt, - NG1311 tpn, - NG1317 NG1314 rpoZ, - NG1309 gmk,kguA, - NG1310 NG1312 tbpA,hmbR, - NG1316.1 tbpA, - NG1316 spoT, - NG1308 NG1313 NG1315 aprt,apt, - NG1311 tpn, - NG1317 NG1314 rpoZ, - NG1309 gmk,kguA, - NG1310 NG1312 tbpA,hmbR, - NG1316.1 tbpA, - NG1316 spoT, - NG1308 NG1313 NG1315 aprt,apt, - NG1311 tpn, - NG1317 NG1314

IGS ID: IGR1071

DNA Molecule Name:
1  

IGS Start:
1270028

IGS Stop:
1270190

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TGAAACATTTTTACAAAGCATACAAATCATGCTTCAACACACAGGACGAC
ACATAAAGCACCGCCCTATATGTCGTCCTGATTCGGAAGGGGTTACGCCC
CTCCCAAATAAAGTCTGATCCTGCCGCCCTAAAGGGCGGGGTTTCAACCG
AAAAGGAAACACG



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy