Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Neisseria gonorrhoeae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap rRNA-16S-2 IGR1070 IGR1069 IGR1067 IGR1064 IGR1065 IGR1066 IGR1068 IGR1072 IGR1071 IGR1073 IGR1063 rpoZ, - NG1309 NG1306 gmk,kguA, - NG1310 NG1312 spoT, - NG1308 NG1313 NG1315 aprt,apt, - NG1311 dfp, - NG1307 NG1314 rpoZ, - NG1309 NG1306 gmk,kguA, - NG1310 NG1312 spoT, - NG1308 NG1313 NG1315 aprt,apt, - NG1311 dfp, - NG1307 NG1314 Type: direct, Name:  - 101 Type: direct, Name:  - 105 Type: direct, Name:  - 109 rpoZ, - NG1309 NG1306 gmk,kguA, - NG1310 NG1312 spoT, - NG1308 NG1313 NG1315 aprt,apt, - NG1311 dfp, - NG1307 NG1314

IGS ID: IGR1066

DNA Molecule Name:
1  

IGS Start:
1267332

IGS Stop:
1267426

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TTCAGACGGCTTTCGGGATGTATGTGTTTTTTCATTTCAAACCGTCGGAC
TGCACGGCGGCAGAGTGTGTCGGCGTGCGTTTCCGGCAGAATTTA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy