Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Neisseria gonorrhoeae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap tRNA-Ala-2 tRNA-Ile-1 rRNA-16S-2 rRNA-23S-2 IGR1067 IGR1065 IGR1064 IGR1066 IGR1068 IGR1063 rpoZ, - NG1309 NG1306 gmk,kguA, - NG1310 spoT, - NG1308 aprt,apt, - NG1311 dfp, - NG1307 rpoZ, - NG1309 NG1306 gmk,kguA, - NG1310 spoT, - NG1308 aprt,apt, - NG1311 dfp, - NG1307 Type: direct, Name:  - 108 Type: direct, Name:  - 101 Type: direct, Name:  - 113 Type: direct, Name:  - 104 Type: direct, Name:  - 105 Type: direct, Name:  - 109 Type: direct, Name:  - 123 rpoZ, - NG1309 NG1306 gmk,kguA, - NG1310 spoT, - NG1308 aprt,apt, - NG1311 dfp, - NG1307

IGS ID: IGR1064

DNA Molecule Name:
1  

IGS Start:
1263852

IGS Stop:
1263923

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
ACGGTAACTAATGTATCCGTACTTTGTTATAGAATGGCTGCTGTTTTTTC
TTCGTAATTAGAAATTGTCAAA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy