Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Neisseria gonorrhoeae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap tRNA-Leu-4 IGR1004 IGR1002 IGR1006 IGR1001 IGR1008 IGR1005 IGR1007 IGR1003 NG1234 ilvH, - NG1235 ilvI, - NG1236 NG1237 hisB, - NG1242 hisG, - NG1238 yhaE, - NG1243 NG1239 hisC, - NG1241 hisD,hisX, - NG1240 NG1234 ilvH, - NG1235 ilvI, - NG1236 NG1237 hisB, - NG1242 hisG, - NG1238 yhaE, - NG1243 NG1239 hisC, - NG1241 hisD,hisX, - NG1240 Type: tandem, Name:  - 58 ilvH, - NG1235 ilvI, - NG1236 NG1234 NG1237 hisB, - NG1242 hisG, - NG1238 yhaE, - NG1243 NG1239 hisC, - NG1241 hisD,hisX, - NG1240

IGS ID: IGR1005

DNA Molecule Name:
1  

IGS Start:
1190374

IGS Stop:
1190467

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TGAATAAAGATGCGTTTTCAGACGACCCTATCCGTTCCCGCCGACAGGCC
GTCTGAAAATATCACCGGCAGTAAACTGTATAGGAGAAGTTAAA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy