Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Neisseria gonorrhoeae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap tRNA-Leu-4 IGR1004 IGR1002 IGR1001 IGR1000 IGR1005 IGR0999 IGR0998 IGR1003 NG1234 ilvH, - NG1235 ilvC, - NG1233 ilvI, - NG1236 NG1237 hisG, - NG1238 NG1239 otcC,argF, - NG1232 acnB, - NG1231 NG1234 ilvH, - NG1235 ilvC, - NG1233 ilvI, - NG1236 NG1237 hisG, - NG1238 NG1239 otcC,argF, - NG1232 acnB, - NG1231 Type: tandem, Name:  - 58 ilvH, - NG1235 ilvC, - NG1233 ilvI, - NG1236 NG1234 NG1237 NG1239 otcC,argF, - NG1232 acnB, - NG1231 hisG, - NG1238

IGS ID: IGR1001

DNA Molecule Name:
1  

IGS Start:
1185619

IGS Stop:
1185687

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
AAATCTCTCCTGCCGTTCGTTTTTCAGACGGCATTCAAATACCATGCCGT
CTGAAAGGTTACGGCGTTA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy