Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Neisseria gonorrhoeae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR0996 IGR1002 IGR1001 IGR1000 IGR0999 IGR0998 IGR0997 IGR1003 NG1234 ilvH, - NG1235 ilvC, - NG1233 ilvI, - NG1236 NG1230 otcC,argF, - NG1232 NG1229 NG1228 acnB, - NG1231 NG1234 ilvH, - NG1235 ilvC, - NG1233 ilvI, - NG1236 NG1230 otcC,argF, - NG1232 NG1229 NG1228 acnB, - NG1231 ilvH, - NG1235 ilvC, - NG1233 ilvI, - NG1236 NG1234 NG1230 otcC,argF, - NG1232 NG1229 NG1228 acnB, - NG1231

IGS ID: IGR0998

DNA Molecule Name:
1  

IGS Start:
1182974

IGS Stop:
1183117

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TGATCCCCGTCATCCGTATGGAGTAAGGGATTGACCGCAATGCCGTCTGA
ACAACCTTCAGACGGCATTGCAACATTCCGCTAACCCTTCTTTCCGCAAA
CGCTGCAAATACGGCGTTCACGCCCCCACATAAAGGAAACGACA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy