Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Neisseria gonorrhoeae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR0858 IGR0859 IGR0860 IGR0854 IGR0855 IGR0861 IGR0856 IGR0853 IGR0862 IGR0857 dmpI, - NG1048 syw, - NG1045 aat, - NG1047 NG1054 NG1051 recX,oraA, - NG1053 vdlD, - NG1055 gph, - NG1052 NG1049 clpB, - NG1046 dmpI, - NG1048 syw, - NG1045 aat, - NG1047 NG1054 NG1051 recX,oraA, - NG1053 vdlD, - NG1055 gph, - NG1052 NG1049 clpB, - NG1046 dmpI, - NG1048 syw, - NG1045 aat, - NG1047 NG1051 recX,oraA, - NG1053 vdlD, - NG1055 gph, - NG1052 NG1049 clpB, - NG1046 NG1054

IGS ID: IGR0856

DNA Molecule Name:
1  

IGS Start:
1010294

IGS Stop:
1010484

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
GATATTTCTCCGTTTTGAAATATTGCTATCTTATCAAACAAGTTGCCTCC
GCCCAAACGTCCGCTTCATTTTCTGAAAAATTCAAATCGATACAAAAAGA
CAGTTTTCAGGCGGCAAATCCGTCTTCACACGATACATATTTTGTTATAG
CATAACAAAATTTTTAACCCGCACGATATAAAGGCTGCACC



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy