Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Neisseria gonorrhoeae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR0725 IGR0721 IGR0722 IGR0717 IGR0718 IGR0724 IGR0719.1 IGR0723 IGR0720 IGR0716.2 IGR0719 NG0867 NG0865 NG0867.1 NG0871 ggt, - NG0864.1 dedA, - NG0869 opcA, - NG0868 dcrD, - NG0874 dcmD, - NG0873 glyA, - NG0866 trpE, - NG0872 uup,abcZ, - NG0870 NG0867 NG0865 NG0867.1 NG0871 ggt, - NG0864.1 dedA, - NG0869 opcA, - NG0868 dcrD, - NG0874 dcmD, - NG0873 glyA, - NG0866 trpE, - NG0872 uup,abcZ, - NG0870 NG0867 NG0867.1 NG0871 ggt, - NG0864.1 dedA, - NG0869 opcA, - NG0868 dcmD, - NG0873 glyA, - NG0866 trpE, - NG0872 uup,abcZ, - NG0870 NG0865 dcrD, - NG0874

IGS ID: IGR0721

DNA Molecule Name:
1  

IGS Start:
853073

IGS Stop:
853093

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TAATTGTTGGAAATTGACATT



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy