Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Neisseria gonorrhoeae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR0712 IGR0713 IGR0710 IGR0717 IGR0718 IGR0711 IGR0715 IGR0716.2 IGR0709.1 IGR0714 IGR0716 IGR0719 IGR0716.1 NG0863 NG0861 folB, - NG0857 NG0855 NG0867 NG0865 NG0867.1 NG0860 ggt, - NG0864.1 ggt, - NG0864 NG0858 NG0859 f16p,fbp, - NG0862 glyA, - NG0866 NG0863 NG0861 folB, - NG0857 NG0855 NG0867 NG0865 NG0867.1 NG0860 ggt, - NG0864.1 ggt, - NG0864 NG0858 NG0859 f16p,fbp, - NG0862 glyA, - NG0866 NG0863 NG0861 NG0855 NG0867 folB, - NG0857 NG0865 NG0867.1 NG0860 ggt, - NG0864.1 ggt, - NG0864 NG0858 NG0859 f16p,fbp, - NG0862 glyA, - NG0866

IGS ID: IGR0716

DNA Molecule Name:
1  

IGS Start:
845990

IGS Stop:
846533

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
AATCGCTTTCCTCTCTTGGTTTACGGTTAAAAAGTCAAATTGAATCTTTA
CATTAATTATAACAAAGATAATATTTTTATCCAGTGTTTTGTTATACACG
GCAACACCGTCCGCAGAAAACCGCCCCACCGTCCGATAAAATCGTTGACA
ATCTTCCGCTTTACGCATAAATTTTCAGCCCTTCCTACTGCATATGAAAG
GCACGCCCCAGTTTCCCCAATGTGGATTTTCAGCGCGCGCAGTAGAGGTG
CCGACCCAAATTGGCAGACCCTTTGCTTTTGTTAATATCCTAGAAAATCC
AGAAATTCGCAGTACTCTACCACTCATCGCCAATTGGGCCAACCTTTCCA
CGGCTTTGGGTTAATGGTGAGTTAATCGGTGGTAGTGATATTATCCTACA
AATGTACCAATCAGGTGAGCTAAAACCACTCATTGAAGAGCATAGCCCAA
AGGTCTGATTACTTAATATCTTAAAATAAATATCAAAAAAGACTGCTGAT
GACATTAGCGGTCTTTTTTTGATGGTCAAGATTGATAGTTTGGA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy