Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Neisseria gonorrhoeae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR0510 IGR0508 IGR0511 IGR0509 IGR0512 IGR0507 IGR0513 NG0613 rsuA,psi, - NG0607 NG0606 mltD, - NG0608 NG0609 plsC, - NG0611 fpg, - NG0610 rir1,nrdA, - NG0614 NG0613 rsuA,psi, - NG0607 NG0606 mltD, - NG0608 NG0609 plsC, - NG0611 fpg, - NG0610 rir1,nrdA, - NG0614 NG0613 rsuA,psi, - NG0607 NG0606 mltD, - NG0608 NG0609 plsC, - NG0611 fpg, - NG0610 rir1,nrdA, - NG0614

IGS ID: IGR0510

DNA Molecule Name:
1  

IGS Start:
597467

IGS Stop:
597521

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TAAGGGACGGCCGTCTTTCAGACGGCATCTGTCAGAAGAAATGTCGGGAG
GGGTT



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy