Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Neisseria gonorrhoeae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR0504 IGR0510 IGR0508 IGR0511 IGR0505 IGR0509 IGR0503 IGR0506 IGR0507 hip,ihfB, - NG0603 kcy,mssA,cmk, - NG0605 rsuA,psi, - NG0607 NG0606 rpS1, - NG0604 mltD, - NG0608 merR, - NG0602 NG0609 plsC, - NG0611 fpg, - NG0610 hip,ihfB, - NG0603 kcy,mssA,cmk, - NG0605 rsuA,psi, - NG0607 NG0606 rpS1, - NG0604 mltD, - NG0608 merR, - NG0602 NG0609 plsC, - NG0611 fpg, - NG0610 hip,ihfB, - NG0603 kcy,mssA,cmk, - NG0605 rsuA,psi, - NG0607 NG0606 rpS1, - NG0604 mltD, - NG0608 merR, - NG0602 NG0609 plsC, - NG0611 fpg, - NG0610

IGS ID: IGR0507

DNA Molecule Name:
1  

IGS Start:
593416

IGS Stop:
593891

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
ATTGAAACCGTGTCCGATTGAGATAAAGCGGAAATTTTACACGTGATTCT
TAACAGAAATTGACTGAATGTTTTTCAACTGCCTAGTGATTTTCCATGTA
AAATGCATATATTTCAGTGAATATTTCTGATGAGTATAAACCGATGAGGA
AGAATCGGAGTTTATGAACAGATTAATCTGTTATTTTTCTACATCGGTGT
ACGGAAGTGAAATTTTGTTAATCATATTAATGATAGCATTTCAATGATGA
TGAAAGAGAGGGAATTTGAAATAGAAAACCATCTATACAAGGGGAGAAGT
ATAGATGGCAAAACACATTATGGGGAAAACGTCTTGCTCATAATCCTGCT
TGAACAGGCGTTACTTAGACAAGCGGATTATATCGTAAACTAACTGTTTT
TTGAGTTAATTTTTGTAAAACTGCTTATTTAATAAGCATATGGTTGAATA
TAGGGAAATTATGGAATTTTGTTTCA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy