Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Neisseria gonorrhoeae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR0131 IGR0134 IGR0129 IGR0133 IGR0130 IGR0132 IGR0128 IGR0135 IGR0136 IGR0128.1 IGR0127 NG0160 NG0163 NG0162 NG0161 NG0165 troB, - NG0170 NG0169 NG0166 mntC, - NG0168 NG0167 tpn, - NG0159 NG0156 ampN,pepN, - NG0158 NG0160 NG0163 NG0162 NG0161 NG0165 troB, - NG0170 NG0169 NG0166 mntC, - NG0168 NG0167 tpn, - NG0159 NG0156 ampN,pepN, - NG0158 Type: tandem, Name:  - 12 NG0161 troB, - NG0170 NG0169 NG0166 mntC, - NG0168 NG0164 NG0165 NG0160 NG0162 NG0163 NG0164 NG0167 tpn, - NG0159 NG0156 ampN,pepN, - NG0158

IGS ID: IGR0130

DNA Molecule Name:
1  

IGS Start:
168306

IGS Stop:
168364

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
GGCGCGTATAACACGCCATGCCTGATTAAAATTAGTCTCCCTTACCTTAG
AATTTATTA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy