Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Neisseria gonorrhoeae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR0122 IGR0124 IGR0120.2 IGR0123 IGR0126 IGR0121 IGR0127 IGR0125 NG0150 NG0147 rhlE, - NG0149 NG0155 fis, - NG0152 ruvC, - NG0153 NG0156 msbB, - NG0154 nifR3, - NG0151 ampN,pepN, - NG0158 NG0150 NG0147 rhlE, - NG0149 NG0155 fis, - NG0152 ruvC, - NG0153 NG0156 msbB, - NG0154 nifR3, - NG0151 ampN,pepN, - NG0158 NG0150 NG0147 rhlE, - NG0149 NG0148 NG0148 fis, - NG0152 ruvC, - NG0153 NG0156 msbB, - NG0154 nifR3, - NG0151 ampN,pepN, - NG0158 NG0155

IGS ID: IGR0124

DNA Molecule Name:
1  

IGS Start:
161318

IGS Stop:
161358

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TAGTTTCAGACGGCATTTGTATTTTGCCGCCTGAAAAGAAA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy