Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Mycoplasma genitalium Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR242 IGR246 IGR248 IGR247 IGR244 IGR243 IGR245 IGR249 rpL33, - MG325 acpD, - MG333 cmk, - MG330 MG332 MG326 pepP, - MG324 MG329 fcrV, - MG328 valS, - MG334 rpL33, - MG325 acpD, - MG333 cmk, - MG330 MG332 MG326 pepP, - MG324 MG329 fcrV, - MG328 valS, - MG334 Type: inverted, Name:  - 63 rpL33, - MG325 acpD, - MG333 cmk, - MG330 MG332 MG326 pepP, - MG324 MG329 fcrV, - MG328 valS, - MG334 MG331 MG327 MG331 MG327

IGS ID: IGR245

DNA Molecule Name:
1  

IGS Start:
412934

IGS Stop:
412974

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
GGATTATGTTGGAATATTAGATAAATAAGTATATTATCTTA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy