Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Mycoplasma genitalium Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR174 IGR172 IGR173 IGR171 IGR175 MG240 rpL21, - MG232 nfo, - MG235 MG237 tig, - MG238 MG241 nrdE, - MG231 lon, - MG239 MG240 rpL21, - MG232 nfo, - MG235 MG237 tig, - MG238 MG241 nrdE, - MG231 lon, - MG239 Type: inverted, Name:  - 49 Type: inverted, Name:  - 49 MG240 nfo, - MG235 MG237 tig, - MG238 MG241 nrdE, - MG231 lon, - MG239 rpL27, - MG234 MG236 MG236 ysxB, - MG233 rpL27, - MG234 rpL21, - MG232 ysxB, - MG233

IGS ID: IGR172

DNA Molecule Name:
1  

IGS Start:
281960

IGS Stop:
281991

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TAAAATTAAGTTAGCACTAGTAGATACAAAAG



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy