Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Mycoplasma genitalium Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap tRNA-Asp-1 tRNA-Phe-1 tRNA-Pro-1 tRNA-Met-3 tRNA-Met-2 tRNA-Met-1 tRNA-Cys-1 tRNA-Ser-2 IGR156 IGR158 IGR155 IGR157 MG214 pfk, - MG215 MG217 pyk, - MG216 hmw2, - MG218 MG214 pfk, - MG215 MG217 pyk, - MG216 hmw2, - MG218 Type: tandem, Name:  - 5 Type: tandem, Name:  - 6 Type: tandem, Name:  - 7 Type: direct, Name:  - 24 Type: inverted, Name:  - 56 Type: direct, Name:  - 24 Type: inverted, Name:  - 56 MG214 pfk, - MG215 MG217 pyk, - MG216 hmw2, - MG218

IGS ID: IGR158

DNA Molecule Name:
1  

IGS Start:
259156

IGS Stop:
259175

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TAAAAAGCGTGTTTTAACTA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy