Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Haemophilus ducreyi Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap tRNA-Pro-1 tRNA-Arg-2 IGR809 IGR811 IGR813 IGR807 IGR814 IGR810 IGR812 IGR808 IGR804 IGR806 IGR803 IGR805 HD1119 nth, - HD1115 fdoI,fdxI, - HD1111 HD1117 fdhE, - HD1110 HD1120 folA,dyr, - HD1118 fdhD, - HD1113 folD, - HD1108 dapA, - HD1107 htrB, - HD1106 HD1109 HD1119 nth, - HD1115 fdoI,fdxI, - HD1111 HD1117 fdhE, - HD1110 HD1120 folA,dyr, - HD1118 fdhD, - HD1113 folD, - HD1108 dapA, - HD1107 htrB, - HD1106 HD1109 HD1119 nth, - HD1115 fdoI,fdxI, - HD1111 HD1117 fdhE, - HD1110 fdxH, - HD1112 fdxH, - HD1112 folA,dyr, - HD1118 fdhD, - HD1113 folD, - HD1108 dapA, - HD1107 htrB, - HD1106 HD1109 HD1120

IGS ID: IGR807

DNA Molecule Name:
1  

IGS Start:
885911

IGS Stop:
885959

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TTTTAACGGAAAAGCGGTCTAATTTGACCGCTTTTTTATCAGTAATTGT



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy