Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Haemophilus ducreyi Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap tRNA-Pro-1 tRNA-Arg-2 IGR809 IGR807 IGR802 IGR801 IGR808 IGR804 IGR806 IGR803 IGR805 yfiA, - HD1105 fdoI,fdxI, - HD1111 kdkA, - HD1101 fdhE, - HD1110 folE, - HD1103 fdhD, - HD1113 truA,hisT, - HD1104 folD, - HD1108 dapA, - HD1107 htrB, - HD1106 HD1109 yfiA, - HD1105 fdoI,fdxI, - HD1111 kdkA, - HD1101 fdhE, - HD1110 folE, - HD1103 fdhD, - HD1113 truA,hisT, - HD1104 folD, - HD1108 dapA, - HD1107 htrB, - HD1106 HD1109 yfiA, - HD1105 fdoI,fdxI, - HD1111 kdkA, - HD1101 fdhE, - HD1110 fdxH, - HD1112 HD1102 fdxH, - HD1112 HD1102 folE, - HD1103 fdhD, - HD1113 truA,hisT, - HD1104 folD, - HD1108 dapA, - HD1107 htrB, - HD1106 HD1109

IGS ID: IGR805

DNA Molecule Name:
1  

IGS Start:
882918

IGS Stop:
883383

Features:
tRNA-Arg-2  tRNA-Pro-1  

Comment:


IGS Nucleotide sequence:  Sequence Viewer
CCAATTAAGTAAACCAGAAAACTCATCATATAGATGAGTTTTTTATAGAT
CATTTATGCCAAAAATAAATAATGTATTCATAAATATGAATGGATTTTTT
GGAATGAAATGGCACGCCCTAAAGGATTCGAACCTTTGACCCACGCCTTA
GAAGGGCGTTGCTCTATCCAGCTGAGCTAAGGGCGCAAATGAAGATATAA
AAGAGATTTATCGGTATAAAATGGTCGGCGAGATAGGATTTGAACCTACG
ACCCACTGGTCCCAAACCAGTTGCGCTACCAAGCTGCGCTACTCGCCGAT
AAGAATGTAGGCTCATTATAAATTGATTGTTTATTCAGTCAATGTTTTTT
TATAAGTTCAGTGTTTAATTGTTGGTGTTTTGTTCGTTAGCGCGCTAGTC
TTTATTTGCAAATAATCTATTTTCTGACAAAATAACTAAGGTATTAATTA
TTTACAGTAAAATATT



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy