Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Haemophilus ducreyi Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap tRNA-Pro-1 tRNA-Arg-2 IGR799 IGR802 IGR800 IGR801 IGR804 IGR806 IGR803 IGR805 yfiA, - HD1105 kdkA, - HD1101 folE, - HD1103 truA,hisT, - HD1104 hlpA, - HD1100 folD, - HD1108 dapA, - HD1107 htrB, - HD1106 metN, - HD1098 HD1109 yfiA, - HD1105 kdkA, - HD1101 folE, - HD1103 truA,hisT, - HD1104 hlpA, - HD1100 folD, - HD1108 dapA, - HD1107 htrB, - HD1106 metN, - HD1098 HD1109 yfiA, - HD1105 kdkA, - HD1101 HD1102 HD1102 folE, - HD1103 truA,hisT, - HD1104 hlpA, - HD1100 folD, - HD1108 dapA, - HD1107 htrB, - HD1106 metN, - HD1098 HD1109 metI, - HD1099 metI, - HD1099

IGS ID: IGR802

DNA Molecule Name:
1  

IGS Start:
880432

IGS Stop:
880489

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
ATAAAAAAGCCAAATCATTGATTTGGCTTAATGGTTAGTTTAGTTGCTAT
GTCTGGGC



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy