Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Haemophilus ducreyi Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR29 IGR32 IGR33 IGR30 IGR28 IGR31 IGR34 IGR35 HD0044 HD0042 thdF, - HD0039 yidC, - HD0040 HD0043 HD0038 ompA, - HD0045 ompA2, - HD0046 lysA, - HD0036 hemN, - HD0037 HD0044 HD0042 thdF, - HD0039 yidC, - HD0040 HD0043 HD0038 ompA, - HD0045 ompA2, - HD0046 lysA, - HD0036 hemN, - HD0037 thdF, - HD0039 yidC, - HD0040 HD0041 HD0042 HD0041 HD0044 HD0043 HD0038 ompA, - HD0045 ompA2, - HD0046 lysA, - HD0036 hemN, - HD0037

IGS ID: IGR31

DNA Molecule Name:
1  

IGS Start:
37460

IGS Stop:
37609

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TTGGTATCCTTGATGAGTTAAAAAAGCCGTTTTTTGGCTAGTTTTTTACC
CGATATTACTAATTATAGACCGCTTGGTATTGAGTTATCATAGCATAAAA
ATAAAAAAGCACCGTATGGCTAACGGTGCTTGATAGCTTAAAACTCAGCT




Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy