Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Haemophilus ducreyi Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR29 IGR24 IGR25 IGR27 IGR32 IGR33 IGR30 IGR28 IGR31 IGR26 IGR34 HD0044 HD0042 thdF, - HD0039 yidC, - HD0040 HD0035 HD0043 frdD, - HD0034 frdC, - HD0033 HD0038 frdB, - HD0032 ompA, - HD0045 lysA, - HD0036 hemN, - HD0037 HD0044 HD0042 thdF, - HD0039 yidC, - HD0040 HD0035 HD0043 frdD, - HD0034 frdC, - HD0033 HD0038 frdB, - HD0032 ompA, - HD0045 lysA, - HD0036 hemN, - HD0037 thdF, - HD0039 yidC, - HD0040 HD0041 HD0042 HD0041 HD0044 HD0043 frdD, - HD0034 HD0038 frdB, - HD0032 ompA, - HD0045 lysA, - HD0036 hemN, - HD0037 HD0035 frdC, - HD0033

IGS ID: IGR30

DNA Molecule Name:
1  

IGS Start:
36012

IGS Stop:
36100

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
ACAGTATTAGCATAGGCGGTCTAGTTAGCGTAATCTTTTGCTAAGATTGA
GCTTAATTAGACCGCTTATTTTAGCTAGCAAGTAAGCGG



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy