Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Haemophilus ducreyi Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR29 IGR24 IGR25 IGR23 IGR27 IGR21 IGR30 IGR28 IGR26 IGR22 genX, - HD0029 thdF, - HD0039 HD0035 frdD, - HD0034 frdC, - HD0033 HD0038 frdB, - HD0032 dapF, - HD0026 lysA, - HD0036 frdA, - HD0030 hemN, - HD0037 genX, - HD0029 thdF, - HD0039 HD0035 frdD, - HD0034 frdC, - HD0033 HD0038 frdB, - HD0032 dapF, - HD0026 lysA, - HD0036 frdA, - HD0030 hemN, - HD0037 genX, - HD0029 thdF, - HD0039 HD0035 frdC, - HD0033 HD0038 frdB, - HD0032 dapF, - HD0026 lysA, - HD0036 frdA, - HD0030 hemN, - HD0037 frdD, - HD0034

IGS ID: IGR27

DNA Molecule Name:
1  

IGS Start:
32131

IGS Stop:
32170

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TCAGGTTTTAATCAATTAATGGTCAGGTATTTGTAATATA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy