Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Haemophilus ducreyi Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR159 IGR154 IGR158 IGR157 IGR155 IGR156 ptsH, - HD0229 crr, - HD0227 otcC,arcB, - HD0232 carA, - HD0235 ptsI, - HD0228 carB, - HD0233 thiP, - HD0230 ptsH, - HD0229 crr, - HD0227 otcC,arcB, - HD0232 carA, - HD0235 ptsI, - HD0228 carB, - HD0233 thiP, - HD0230 ptsH, - HD0229 crr, - HD0227 otcC,arcB, - HD0232 carA, - HD0235 ptsI, - HD0228 carB, - HD0233 thiP, - HD0230 thiQ, - HD0231 thiQ, - HD0231

IGS ID: IGR157

DNA Molecule Name:
1  

IGS Start:
170863

IGS Stop:
170987

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
GGCGCAGACTGGGCGTGTTTTACGACAAGCGGTTTAATGAACAAAAAAAG
TGTAAATTAAACCGCTTGGATCGTGGTAGGTAGGTTGTAAAATCAAGCAT
AGCGGATTCTACTTAAATAGAGTAA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy