Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Haemophilus ducreyi Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap tRNA-Asp-2 IGR151 IGR152 IGR154 IGR157 IGR155 IGR153 IGR156 IGR150 ptsH, - HD0229 crr, - HD0227 dnaQ, - HD0223 otcC,arcB, - HD0232 HD0226 yjjK, - HD0224 ptsI, - HD0228 thiP, - HD0230 ptsH, - HD0229 crr, - HD0227 dnaQ, - HD0223 otcC,arcB, - HD0232 HD0226 yjjK, - HD0224 ptsI, - HD0228 thiP, - HD0230 ptsH, - HD0229 crr, - HD0227 dnaQ, - HD0223 otcC,arcB, - HD0232 HD0226 yjjK, - HD0224 ptsI, - HD0228 thiP, - HD0230 thiQ, - HD0231 thiQ, - HD0231

IGS ID: IGR154

DNA Molecule Name:
1  

IGS Start:
166165

IGS Stop:
166253

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
AGAAATCTCCATTATTTTAATCTTTATTAAAAAAATTCTCGCATATTTTA
TACGAGAATTTTGTGTTTGTATGCTACTTTATTCGAAAA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy