Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Haemophilus ducreyi Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR1363 IGR1366 IGR1368 IGR1365 IGR1364 IGR1361 IGR1362 IGR1367 sgaA, - HD1859 sgaH, - HD1857 HD1852 nanA, - HD1850 HD1856 sgaT, - HD1860 deoR,glpR, - HD1863 HD1854 HD1861 menD, - HD1853 sgaA, - HD1859 sgaH, - HD1857 HD1852 nanA, - HD1850 HD1856 sgaT, - HD1860 deoR,glpR, - HD1863 HD1854 HD1861 menD, - HD1853 sgaA, - HD1859 sgaH, - HD1857 nanA, - HD1850 HD1856 sgaT, - HD1860 HD1852 deoR,glpR, - HD1863 HD1854 HD1861 menD, - HD1853

IGS ID: IGR1364

DNA Molecule Name:
1  

IGS Start:
1559624

IGS Stop:
1559833

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
GAATTAATCTGCCTATAACGAAGAGGTTATAAACATAATAAAGCAAAAAG
AAAGCACTTTCAAAATAAACTTTAATATTAAAAACAATTAAAAATGGTTA
ATTTACACAATGATTATGCAAATTAACCACTTAATTCAACTGAGTAAAGA
TTAAACTATTAAATGATGTGTTATAACGGATCATTAATTTAATAATTTAA
CCTGTTTTAA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy