Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Haemophilus ducreyi Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR1359 IGR1356 IGR1363 IGR1357 IGR1360 IGR1358 IGR1361 IGR1362 HD1852 nagB, - HD1847 nanA, - HD1850 HD1856 wecA,rfe, - HD1844 wecB,rffE, - HD1843 nagA, - HD1845 wecC, - HD1842 HD1854 menD, - HD1853 HD1852 nagB, - HD1847 nanA, - HD1850 HD1856 wecA,rfe, - HD1844 wecB,rffE, - HD1843 nagA, - HD1845 wecC, - HD1842 HD1854 menD, - HD1853 HD1852 nagB, - HD1847 nanA, - HD1850 HD1856 wecA,rfe, - HD1844 wecB,rffE, - HD1843 nagA, - HD1845 wecC, - HD1842 nanA, - HD1849 nanA, - HD1849 HD1854 menD, - HD1853

IGS ID: IGR1360

DNA Molecule Name:
1  

IGS Start:
1553845

IGS Stop:
1553937

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
AATTTTTCCTTTGATTATCTTATGTATTGATCAAAAAAGGCGAGAAAACA
CCCGCCTTGCAAAAACCATCGACAAGCGGGCCTTTTTAGCCAT



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy