Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Haemophilus ducreyi Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap rRNA-5S-5 rRNA-23S-5 IGR1348 IGR1347 IGR1350 IGR1349 IGR1351 IGR1352 gptA, - HD1831 gmk, - HD1830 HD1829 HD1827 modB, - HD1824 modC, - HD1826 pepD, - HD1832 gptA, - HD1831 gmk, - HD1830 HD1829 HD1827 modB, - HD1824 modC, - HD1826 pepD, - HD1832 gptA, - HD1831 gmk, - HD1830 HD1829 modC, - HD1826 pepD, - HD1832 HD1825 HD1828 HD1827 modB, - HD1824 HD1825 HD1828

IGS ID: IGR1351

DNA Molecule Name:
1  

IGS Start:
1534284

IGS Stop:
1534454

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
AAAAAAGCCCTAGATAAAAAAAAGCGGCGACTAAGCACCGAATAAATAAA
ACTTATCCCATTCTAACCTAAAAAGCACATTCGTGCTATCATTTCCGCAT
CTATTCAGCGATAGCGGTCAATTATTTGAAAATTTTAACCGCTTATTACC
CACCTATTTTAAGAGGCAAAT



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy