Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Haemophilus ducreyi Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap rRNA-5S-5 rRNA-23S-5 IGR1344 IGR1348 IGR1347 IGR1350 IGR1346 IGR1345 IGR1349 IGR1351 IGR1352 gptA, - HD1831 gmk, - HD1830 HD1829 HD1827 modB, - HD1824 modA, - HD1823 yadH, - HD1821 yadG, - HD1820 modC, - HD1826 pepD, - HD1832 gptA, - HD1831 gmk, - HD1830 HD1829 HD1827 modB, - HD1824 modA, - HD1823 yadH, - HD1821 yadG, - HD1820 modC, - HD1826 pepD, - HD1832 gptA, - HD1831 gmk, - HD1830 HD1829 modB, - HD1824 modA, - HD1823 yadH, - HD1821 yadG, - HD1820 modC, - HD1826 pepD, - HD1832 HD1825 HD1828 HD1827 HD1825 HD1828

IGS ID: IGR1348

DNA Molecule Name:
1  

IGS Start:
1531561

IGS Stop:
1531601

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
AAAAGCACGATATAATAATCGTGCTTTTTTGATTGTGGTGA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy