Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Haemophilus ducreyi Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR1343 IGR1340 IGR1341 IGR1337 IGR1338 IGR1336 IGR1339 IGR1335 IGR1342 trxM,trxA, - HD1810 pgsA, - HD1813 hflK, - HD1809 uraA, - HD1811 uvrC, - HD1812 dsvC, - HD1815 apt, - HD1818 yccA, - HD1814 yfeA, - HD1816 dnaX, - HD1819 trxM,trxA, - HD1810 pgsA, - HD1813 hflK, - HD1809 uraA, - HD1811 uvrC, - HD1812 dsvC, - HD1815 apt, - HD1818 yccA, - HD1814 yfeA, - HD1816 dnaX, - HD1819 trxM,trxA, - HD1810 pgsA, - HD1813 hflK, - HD1809 uraA, - HD1811 uvrC, - HD1812 dsvC, - HD1815 apt, - HD1818 yccA, - HD1814 yfeA, - HD1816 dnaX, - HD1819 yfeB, - HD1817 yfeB, - HD1817

IGS ID: IGR1339

DNA Molecule Name:
1  

IGS Start:
1520612

IGS Stop:
1520793

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
AGCTAGCGCGGAAAGGTAAAAATTCAGTTTATTTAGTGTATCACAGTACT
CAACAATCAGCTATTGCTCGCTAAATTTAATCCTATACATTCTTTAAAAA
CGACTAATTTACACTTGATTTATGGGATTTTGTCCATATATAGCTTATAA
TTTTCGAGCTTTATCATTAAAGAGGAAACAAA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy