Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Haemophilus ducreyi Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR1234 IGR1228 IGR1232 IGR1229 IGR1231 IGR1230 IGR1233 HD1687 HD1688 bioC, - HD1681 tpn, - HD1689 bioF, - HD1684 mod, - HD1691 bioA, - HD1685 res, - HD1690 yfcB, - HD1686 HD1687 HD1688 bioC, - HD1681 tpn, - HD1689 bioF, - HD1684 mod, - HD1691 bioA, - HD1685 res, - HD1690 yfcB, - HD1686 HD1688 bioC, - HD1681 tpn, - HD1689 bioF, - HD1684 mod, - HD1691 bioA, - HD1685 res, - HD1690 HD1682 HD1682 HD1687 yfcB, - HD1686

IGS ID: IGR1231

DNA Molecule Name:
1  

IGS Start:
1405702

IGS Stop:
1405785

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
AAAAAATACCTTTACCCATTTATACAGGTAAAGGTATTTTACTTTATTTT
TATTTCAAGCACTAAAATGAATTAAGTGCCAATA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy