Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Haemophilus ducreyi Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR1214 IGR1216 IGR1208 IGR1209 IGR1210 IGR1211 IGR1215 IGR1212 IGR1213 HD1656 HD1657 nlpD, - HD1658 pntB, - HD1662 pntA, - HD1663 HD1655 HD1654 dcd, - HD1661 udk, - HD1660 gpmA, - HD1659 HD1656 HD1657 nlpD, - HD1658 pntB, - HD1662 pntA, - HD1663 HD1655 HD1654 dcd, - HD1661 udk, - HD1660 gpmA, - HD1659 HD1657 nlpD, - HD1658 pntB, - HD1662 pntA, - HD1663 HD1655 HD1654 HD1656 dcd, - HD1661 udk, - HD1660 gpmA, - HD1659

IGS ID: IGR1212

DNA Molecule Name:
1  

IGS Start:
1380896

IGS Stop:
1381049

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
CCATAAACTATTATTAAACTTACTATTTTAATTAAATCTTTGAGGAAAAT
CAGCTTTTCTGTTGCTTTTATAAAAAGAAATAATATAACTGTTTCAAAGT
ATATTGATTTTTGTTATAAATGTACCATTTTCAAATCAATATTAACACAA
AGGA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy