Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Haemophilus ducreyi Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR7 IGR6 IGR3 IGR5 IGR1498 IGR1.1 IGR4 IGR1 IGR2 IGR1499 yckJ, - HD2033 yckK, - HD2035 atpE, - HD0005 HD0003 atpF, - HD0006 HD2037 atpH, - HD0007 gidB, - HD0002 atpA, - HD0004 atpA, - HD0008 gidA, - HD0001 yckJ, - HD2033 yckK, - HD2035 atpE, - HD0005 HD0003 atpF, - HD0006 HD2037 atpH, - HD0007 gidB, - HD0002 atpA, - HD0004 atpA, - HD0008 gidA, - HD0001 yckJ, - HD2033 yckK, - HD2035 HD2034 HD2034 atpE, - HD0005 HD0003 atpF, - HD0006 HD2037 atpH, - HD0007 gidB, - HD0002 atpA, - HD0004 atpA, - HD0008 gidA, - HD0001

IGS ID: IGR1.1

DNA Molecule Name:
1  

IGS Start:
2189

IGS Stop:
2292

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TGTTAAGTAAAGTGAGTAAGTGGATTGCTTGCTCACTTTTTTAGTGAGCC
CAACCGTTCTTATTTGTTTTTATCCAAATAAACAAAGATGAAGGAATTTG
TAAA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy