Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR838 IGR833 IGR835 IGR834 IGR837 IGR839 IGR836 CPn1051 CPn1056 CPn1052 CPn1055 dapA, - CPn1050 lysC, - CPn1049 CPn1057 CPn1054 CPn1051 CPn1056 CPn1052 CPn1055 dapA, - CPn1050 lysC, - CPn1049 CPn1057 CPn1054 Type: direct, Name:  - 13 Type: direct, Name:  - 18 Type: direct, Name:  - 19 CPn1052 CPn1055 dapA, - CPn1050 lysC, - CPn1049 CPn1057 CPn1054 CPn1053 asd, - CPn1048 asd, - CPn1048 CPn1053 CPn1051 CPn1056

IGS ID: IGR836

DNA Molecule Name:
1  

IGS Start:
1206705

IGS Stop:
1207033

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
AAATAGTTCTTGTTCTCTTGGACTTGAAAAAGCCATTCCTATTTGAAAAA
ATGGGAATGGCTTTTTTTATAATAGGTCGAACCAAAGAGGAACTTGTTTC
ATTAAAATTACTTAAAAAGTGATATCGTTTTCTAAATACAAAGATAAAAA
TACTCACCAATATACTCGCACAACCTTGACAAAGGAAGTTTTCTTGAAGA
TCTTTTTCGGTTTTTATAAGAAAATTCTTCTTTAGAAGGAAGATGAATCT
CTTTGAATAAAATACTATATATTAGTAGCTTAGTGGGTTTAATTTATGTG
TTTGATCGCGATGGCACCACAGATTCATA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy