Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR11 IGR9 IGR7 IGR10 IGR8 IGR12 IGR6 CPn0008 CPn0011 CPn0010 CPn0009 CPn0010.1 CPn0012 CPn0007 CPn0008 CPn0011 CPn0010 CPn0009 CPn0010.1 CPn0012 CPn0007 Type: direct, Name:  - 18 Type: tandem, Name:  - 1 Type: direct, Name:  - 13 Type: direct, Name:  - 14 Type: direct, Name:  - 19 CPn0008 CPn0011 CPn0010 CPn0009 CPn0010.1 CPn0012 CPn0007

IGS ID: IGR8

DNA Molecule Name:
1  

IGS Start:
13123

IGS Stop:
13434

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
CCTGAAGAGATTTAAAAGATCCTGAAAGAGAAAACACCTCTTGTGGCTAG
AGTGCGTTCTTTATTTACTCGCGAGGACCATACCTAGCATAAAACTCCAG
GAGCTGTGTTTCTTTAAAATTCTTTGAATAAAATACTATATATTAGTAGC
TTAGTGGGTTTAATTTATGTGTTTGATCGCGATGGCACCACAGATTCATA
ATGCAAGTACTTCTATCTCCGCAGCTACCCCCCCCCCCCCCAACACTCTG
TAGGGTCGATTTCTTCTCCATCTAAACTTCGCGTTTTAGCGATTACTTTT
TTAGTTTTTGGT



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy