Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR771 IGR776 IGR778 IGR775 IGR773 IGR777 IGR774 IGR772 IGR780 IGR779 ftsY, - CPn0972 CPn0969.1 CPn0975 yccA_2, - CPn0971 sucD, - CPn0974 sucC, - CPn0973 tyrP_2, - CPn0970 tyrP_1, - CPn0969 mrsA, - CPn0967 glmS, - CPn0968 ftsY, - CPn0972 CPn0969.1 CPn0975 yccA_2, - CPn0971 sucD, - CPn0974 sucC, - CPn0973 tyrP_2, - CPn0970 tyrP_1, - CPn0969 mrsA, - CPn0967 glmS, - CPn0968 Type: direct, Name:  - 15 Type: direct, Name:  - 21 Type: direct, Name:  - 15 Type: direct, Name:  - 20 Type: direct, Name:  - 12 Type: direct, Name:  - 20 Type: direct, Name:  - 17 Type: direct, Name:  - 12 Type: direct, Name:  - 21 Type: direct, Name:  - 17 ftsY, - CPn0972 CPn0969.1 CPn0975 yccA_2, - CPn0971 sucD, - CPn0974 sucC, - CPn0973 tyrP_2, - CPn0970 tyrP_1, - CPn0969 mrsA, - CPn0967 glmS, - CPn0968

IGS ID: IGR775

DNA Molecule Name:
1  

IGS Start:
1114652

IGS Stop:
1114701

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
ATTTGTTTTGCTCTATTTTTCAATTTCAAGTGAGCAAATAGGAGGGTTCT




Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy