Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR771 IGR769 IGR773 IGR767 IGR772 IGR768 IGR770 pcnB_2, - CPn0966 CPn0964 lpxB, - CPn0965 CPn0969.1 tyrP_1, - CPn0969 mrsA, - CPn0967 glmS, - CPn0968 pcnB_2, - CPn0966 CPn0964 lpxB, - CPn0965 CPn0969.1 tyrP_1, - CPn0969 mrsA, - CPn0967 glmS, - CPn0968 Type: direct, Name:  - 20 Type: direct, Name:  - 12 Type: direct, Name:  - 15 Type: direct, Name:  - 17 Type: direct, Name:  - 21 pcnB_2, - CPn0966 CPn0964 lpxB, - CPn0965 tyrP_1, - CPn0969 mrsA, - CPn0967 glmS, - CPn0968 CPn0969.1

IGS ID: IGR770

DNA Molecule Name:
1  

IGS Start:
1108038

IGS Stop:
1108511

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TATTATAGTTATTAAGAGTTAAAAGTCTTGGAAGAAAAAGAGTGTGTAGT
TTGCGTCTACTTCCATTTTAAAATCCCAACATAGCAAAACTAGGGAAGTT
TTCAAGGATAAAAATGAAAAACAAAAGATGTTTTCTATAGAGATTCCTCT
TCAATTTTTAATTATATATGGATCATTCTTAAGACTCTAGCATCCACAGA
ACCCGGTAGAGAGCTCTTAAATGCCTTGATCCTGGGGAGCAGAAAGGATG
TAAAAAGCATGGAATAAAAAATATCTAGTTTCTGACAGAATTCAATTATA
GAACTTTACATCCATTGGAGAGTTCTCTATAGAAGATCGAAGTATTCTTC
GAGAAGAGTACTACAGTCAGAGGCTACTTTCTTTTACTTATAGTTTACTG
CTTATAAATTCGCTTTTATTTGTGCGTGTAGAAGTGAAAAGATACGGAGA
ATAGGAATAGATTTTAGGAGAAAC



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy