Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR75 IGR72 IGR71 IGR74 IGR70 IGR73 CPn0085 CPn0084 atpE, - CPn0086 tal, - CPn0083 atpB, - CPn0089 atpA, - CPn0088 rpoC, - CPn0082 CPn0085 CPn0084 atpE, - CPn0086 tal, - CPn0083 atpB, - CPn0089 atpA, - CPn0088 rpoC, - CPn0082 CPn0085 CPn0084 atpE, - CPn0086 tal, - CPn0083 atpB, - CPn0089 atpA, - CPn0088 rpoC, - CPn0082 CPn0087 CPn0087

IGS ID: IGR71

DNA Molecule Name:
1  

IGS Start:
103316

IGS Stop:
103361

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TTGCTTACTAAATTAAGCCGGTTTGGGGATACCACCTTAAAGCGAA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy