Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR685 IGR688 IGR687 IGR686 birA, - CPn0866 fliF, - CPn0860 yfhO,nifS, - CPn0862 fliI, - CPn0858 cadA,zntA, - CPn0868 CPn0865 yjbC, - CPn0864 rodA, - CPn0867 birA, - CPn0866 fliF, - CPn0860 yfhO,nifS, - CPn0862 fliI, - CPn0858 cadA,zntA, - CPn0868 CPn0865 yjbC, - CPn0864 rodA, - CPn0867 birA, - CPn0866 fliF, - CPn0860 yfhO,nifS, - CPn0862 fliI, - CPn0858 cadA,zntA, - CPn0868 CPn0859 pgmA, - CPn0863 nifU, - CPn0861 pgmA, - CPn0863 nifU, - CPn0861 CPn0859 CPn0865 yjbC, - CPn0864 rodA, - CPn0867

IGS ID: IGR687

DNA Molecule Name:
1  

IGS Start:
981515

IGS Stop:
981669

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
ATGTTCCTACTAGAATTTAGGGTGAGAAGCTAAGCATAAGCAGAAATCAA
CTTTTGTCTAGTAGAAAATATAGAAGTAAAAAAAGTTTTTAAGCAAAGAA
AAGTAGACCAGTATTGCCTTGCTTAGGCACAATAGGTGCTTGATATGGGG
TAAAC



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy