Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR680 IGR684 IGR682 IGR681 IGR683 CPn0857 ompB, - CPn0854 CPn0856 mreB, - CPn0850 CPn0853 pckA, - CPn0851 CPn0852 CPn0857 ompB, - CPn0854 CPn0856 mreB, - CPn0850 CPn0853 pckA, - CPn0851 CPn0852 ompB, - CPn0854 CPn0856 gpdA  gpsA, - CPn0855 gpdA  gpsA, - CPn0855 CPn0857 mreB, - CPn0850 CPn0853 pckA, - CPn0851 CPn0852

IGS ID: IGR682

DNA Molecule Name:
1  

IGS Start:
970617

IGS Stop:
970636

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TACTTAGGAAATAGAATATT



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy