Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR676 IGR675 IGR669 IGR671 IGR673 IGR672 IGR674 IGR670 CPn0842 CPn0843 clpP_2, - CPn0847 pcnB_1, - CPn0845 clpX, - CPn0846 yphC, - CPn0844 psdD, - CPn0839 CPn0840 secA, - CPn0841 CPn0842 CPn0843 clpP_2, - CPn0847 pcnB_1, - CPn0845 clpX, - CPn0846 yphC, - CPn0844 psdD, - CPn0839 CPn0840 secA, - CPn0841 CPn0843 clpP_2, - CPn0847 pcnB_1, - CPn0845 clpX, - CPn0846 yphC, - CPn0844 CPn0842 psdD, - CPn0839 CPn0840 secA, - CPn0841

IGS ID: IGR671

DNA Molecule Name:
1  

IGS Start:
954644

IGS Stop:
954706

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
GAAATAACCTAGAAGGAGGAGTCCTTCTAGGTATTTGTTTCACAGGCTAC
ATAGTTTTTATTT



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy