Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR664 IGR665 IGR660 IGR666 IGR661 IGR662 IGR663 braB,brnQ, - CPn0836 lpdA, - CPn0833 mot1, - CPn0835 CPn0831 CPn0834 CPn0830 CPn0829 braB,brnQ, - CPn0836 lpdA, - CPn0833 mot1, - CPn0835 CPn0831 CPn0834 CPn0830 CPn0829 braB,brnQ, - CPn0836 lpdA, - CPn0833 mot1, - CPn0835 lipA, - CPn0832 lipA, - CPn0832 CPn0831 CPn0834 CPn0829 CPn0830

IGS ID: IGR664

DNA Molecule Name:
1  

IGS Start:
942018

IGS Stop:
942041

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
TTAGCACTAAATACAATTTCTTCG



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy