Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR651 IGR652 IGR655 IGR649 IGR656 IGR657 IGR650 IGR653 IGR658 IGR654 IGR659 sctS,yscS,fliQ, - CPn0824 yscL,sctL, - CPn0826 CPn0827 yscT,sctT, - CPn0823 sctR,yscR, - CPn0825 yscJ,sctJ, - CPn0828 CPn0818 CPn0822 CPn0820 CPn0821 gspF, - CPn0817 gspE, - CPn0816 sctS,yscS,fliQ, - CPn0824 yscL,sctL, - CPn0826 CPn0827 yscT,sctT, - CPn0823 sctR,yscR, - CPn0825 yscJ,sctJ, - CPn0828 CPn0818 CPn0822 CPn0820 CPn0821 gspF, - CPn0817 gspE, - CPn0816 sctS,yscS,fliQ, - CPn0824 yscL,sctL, - CPn0826 CPn0827 yscT,sctT, - CPn0823 sctR,yscR, - CPn0825 yscJ,sctJ, - CPn0828 CPn0822 CPn0821 gspF, - CPn0817 gspE, - CPn0816 CPn0819 CPn0818 CPn0820 CPn0819

IGS ID: IGR654

DNA Molecule Name:
1  

IGS Start:
931233

IGS Stop:
931497

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
AACTACTTTTTCCCTAAAGGCAAAATGTTGAAGCCCTCCTTTCCTCAACT
TTTTGCCTTGTTTTCAGGCATGTTCGTCGAGAGCTCACAGGCTGGAACGT
ATCTCATGTTTTAAGAGATGCATCCTTTTCTATAGTCTTGAATTTATAGA
TTCTTAGATTACAAAAGAATATGCGAGAGATTCCCTAAGATAATCCATAA
ACAGTGCGCTAAGATTCGTAAGTGAGCGCATCTCCAGATAAGAGTCACGA
TAAGAGCCTAGGGGA



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy