Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR651 IGR652 IGR655 IGR649 IGR656 IGR650 IGR653 IGR654 sctS,yscS,fliQ, - CPn0824 yscT,sctT, - CPn0823 sctR,yscR, - CPn0825 CPn0818 CPn0822 CPn0820 CPn0821 gspF, - CPn0817 CPn0814 gspD, - CPn0815 sctS,yscS,fliQ, - CPn0824 yscT,sctT, - CPn0823 sctR,yscR, - CPn0825 CPn0818 CPn0822 CPn0820 CPn0821 gspF, - CPn0817 CPn0814 gspD, - CPn0815 sctS,yscS,fliQ, - CPn0824 yscT,sctT, - CPn0823 sctR,yscR, - CPn0825 CPn0822 CPn0821 gspF, - CPn0817 CPn0814 gspD, - CPn0815 CPn0819 gspE, - CPn0816 gspE, - CPn0816 CPn0818 CPn0820 CPn0819

IGS ID: IGR650

DNA Molecule Name:
1  

IGS Start:
928291

IGS Stop:
928313

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
AGTGTGTACTCAGAGGAGTCGGT



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy