Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae Search Results



 Intergenic Region
Record: 1 of 1  
MiniMap IGR604 IGR608 IGR607 IGR603 IGR609 IGR605 IGR606 ygfA, - CPn0763 recA, - CPn0762 CPn0764 CPn0766 CPn0761 CPn0760 CPn0768 folP, - CPn0758 ygfA, - CPn0763 recA, - CPn0762 CPn0764 CPn0766 CPn0761 CPn0760 CPn0768 folP, - CPn0758 ygfA, - CPn0763 recA, - CPn0762 CPn0764 CPn0766 CPn0765 CPn0765 CPn0761 folP, - CPn0758 CPn0767 folX, - CPn0757 folA, - CPn0759 folX, - CPn0757 folA, - CPn0759 CPn0760 CPn0768 CPn0767

IGS ID: IGR606

DNA Molecule Name:
1  

IGS Start:
859598

IGS Stop:
859968

Features:


Comment:


IGS Nucleotide sequence:  Sequence Viewer
GTAAATGCTCCTCTTGGTTTCCATATTCCCCAGAGAATAGTTCTGTTTCT
CTGAGAATCGAGAGAAATAGAGAAGTTCTTCTCATAGTTAGTTGAGAGAT
TTGGGGGTGGAAGGTTTTAGATGATGTGTATCATTCTGTATTGTTTTGCT
CTCTATGCATACTTGAATTTGCCATGGCAGTCAAGGCAAAAAGTAACTTC
AAGATGGCTTGTTATTTCTCAATAAATTTAAGAAAAGCACTAGAATACAA
GGACCTTAGTTTCAGATAGTATATCTAAATTATGAAACTGAAAAAATAGA
TCTATTGGATGCCGAGATTCCTTTAACAAGGGAAACTATTTTCAAAAAAT
CAAAAGAACTTCTTCTTATTT



Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy